Padlock: Design padlock probes for in-situ sequencing

Input
Results
Help

Source sequences for target design

Ensembl gene/transcript name(s) or FASTA sequence

Attribute identifier

Feature identifier

FASTA input: Source sequence is absent in reference genome:

Probe design

Probe arm length

Min. genome distance

Use hamming distance (default is edit distance):

Only one arm needs to be unique (default is both arms):

Allow overlapping probes (default is non-overlapping):

Color codes and pre-defined or custom barcodes

Amount of colors

Length of code

Custom barcodes
Color code and barcode file in FASTA format (.fa, .fa.gz). Example:


		  >143312

		  TCAGGCTAGTGTCCAACGGA

		  >112431

		  AAATCCGATCGGCCTAACGG

Anchor and spacer sequences

Anchor

Spacer left

Spacer right

Select genome

Application Description

Padlock is a method to design probes for in-situ sequencing.

Accepted Input

You need to input Ensembl gene (e.g., ENSG00000232810) or transcript identifiers (e.g., ENST00000700026). For gene identifiers use "gene_id" as attribute and "transcript_id" for transcript identifiers. Gene symbols are currently not supported. Alternatively, you can also input a FASTA sequence with a header like ">Input" followed by the actual sequence. For FASTA input, you need to specify whether the sequence is present in the genome (default) or absent.

Sample Data

The "Show Example" button loads an example reference genome with matching Ensembl gene identifiers.

Output

Padlock displays a table of designed padlock probes. The columns include a gene identifier, barcode sequence, genomic position and a UCSC Genome Browser link if the genome is available on UCSC. Furthermore, padlock's output includes strand and feature coordinates, the probe and padlock sequences and some basic quality control metrics such as melting temperature and GC content. You can download the full results as a TSV file via the download link.